/tags/rna-distance-based-contact-maps/ Recent content in RNA distance-based contact maps on Sparks Lab Hugo -- gohugo.io Sun, 27 Jun 2021 00:00:00 +0000 /server/spot-rna-2d/ Sun, 27 Jun 2021 00:00:00 +0000 /server/spot-rna-2d/ Our resources are limited. If you wish to run several batches per day please make use of the downloadable package or contact the administrator directly. Submit E-mail address (required): Target (optional): Input your RNA Sequences: Maximum: 500 nts for SPOT-RNA-2D and 10,000 for SPOT-RNA-2D-Single, Only one RNA sequence at a time >Example sequence 6p2h_A GGGUGUAAUCUCCAAAAUAUGGUUGGGGAGCCUCCACCAGUGAACCGUAAAAUCGCUGUC ACCACCCAG Predictor: SPOT-RNA-2D (default) SPOT-RNA-2D-Single Evolution-coupling analysis method: GREMLIN (default) plmc mfDCA_apc ---