Pseudoknot bps on Sparks Lab /tags/pseudoknot-bps/ Recent content in Pseudoknot bps on Sparks Lab Hugo -- gohugo.io Tue, 15 Jun 2021 00:00:00 +0000 SPOT-RNA SERVER in Shenzhen /server/spot-rna-sz/ Tue, 15 Jun 2021 00:00:00 +0000 /server/spot-rna-sz/ TEST RUN, DO NOT USE Under Development Submit E-mail address (optional): Target (optional): Input your RNA Sequences: Maximum: 2000 nts, Only one RNA sequence at a time >Example sequence 4wj4_B UCCGCGAUAGCUCAGUCGGUAGAGCAAAUGACUGUUAAUCAUUGGGUCCCUGGUUCGAGU CCAGGUCGCGGAGCCA Secondary structure prediction method: SPOTRNA (default) RNAfold Evolution-coupling analysis method: GREMLIN (default) plmc mfDCA_apc --- SPOT-RNA2: Improved RNA Secondary Structure and Tertiary Base-pairing Prediction using Evolutionary Profile, Mutational Coupling and Two-dimensional Transfer Learning. /server/spot-rna2/ Tue, 15 Sep 2020 00:00:00 +0000 /server/spot-rna2/ Our resources are limited and this webserver is sharing by 10-12 other predictors. Therefore, SPOT-RNA2 prediction can take few days. Please don’t submit the same sequence again. If need urgent prediction, please contact jaswinder.singh3@griffithuni.edu.au Submit E-mail address (required): Target (optional): Input your RNA Sequences: Maximum: 500 nts, Only one RNA sequence at a time >6cae-1-1y GGGUGAUUAGCUCAGGGGAGAGCACCUCCCUACAAGGAGGGGGUCGGCGGUUCGAUCCCG UCAUCACCCACCA SPOT-RNA: RNA Secondary Structure Prediction using an Ensemble of Two-dimensional Deep Neural Networks and Transfer Learning. /server/spot-rna/ Wed, 29 Jan 2020 00:00:00 +0000 /server/spot-rna/ Our resources are limited. If you wish to run several batches per day please make use of the downloadable package or contact the administrator directly. Submit E-mail address (optional): Target (optional): Input your RNA Sequences: Maximum: 2000 nts, Only one RNA sequence at a time >Example sequence 4wj4_B UCCGCGAUAGCUCAGUCGGUAGAGCAAAUGACUGUUAAUCAUUGGGUCCCUGGUUCGAGU CCAGGUCGCGGAGCCA Secondary structure prediction method: SPOTRNA (default) RNAfold Evolution-coupling analysis method: GREMLIN (default) plmc mfDCA_apc ---