MSA on Sparks Lab /tags/msa/ Recent content in MSA on Sparks Lab Hugo -- gohugo.io Sat, 30 Oct 2021 00:00:00 +0000 RNAcmap2: An improved fully automatic pipeline for predicting contact maps of RNAs by evolutionary coupling analysis. /server/rnacmap2/ Sat, 30 Oct 2021 00:00:00 +0000 /server/rnacmap2/ Our resources are limited. If you wish to run several batches per day please make use of the downloadable package or contact the administrator directly. Submit E-mail address (required): Target (optional): Input your RNA Sequences: Only one RNA sequence at a time with maximum 500 nts >Example sequence 6p2h_A GGGUGUAAUCUCCAAAAUAUGGUUGGGGAGCCUCCACCAGUGAACCGUAAAAUCGCUGUC ACCACCCAG DCA Predictor: mfDCA (default) PLMC GREMLIN plmDCA SPOT-RNA2: Improved RNA Secondary Structure and Tertiary Base-pairing Prediction using Evolutionary Profile, Mutational Coupling and Two-dimensional Transfer Learning. /server/spot-rna2/ Tue, 15 Sep 2020 00:00:00 +0000 /server/spot-rna2/ Our resources are limited and this webserver is sharing by 10-12 other predictors. Therefore, SPOT-RNA2 prediction can take few days. Please don’t submit the same sequence again. If need urgent prediction, please contact jaswinder.singh3@griffithuni.edu.au Submit E-mail address (required): Target (optional): Input your RNA Sequences: Maximum: 500 nts, Only one RNA sequence at a time >6cae-1-1y GGGUGAUUAGCUCAGGGGAGAGCACCUCCCUACAAGGAGGGGGUCGGCGGUUCGAUCCCG UCAUCACCCACCA RNAcmap: A Fully Automatic Server for RNA Contact Map Prediction by Evolutionary Coupling /server/rnacmap/ Mon, 13 Jan 2020 00:00:00 +0000 /server/rnacmap/ Submit E-mail address (optional): Target (optional): Input your RNA Sequences: Maximum: 500 nts, Only one RNA sequence at a time >Example sequence 3Q3Z_A GCGCGGAAACAAUGAUGAAUGGGUUUAAAUUGGGCACUUGACUCAUUUUGAGUUAGUAGU GCAACCGACCGUGCU Secondary structure prediction method: SPOTRNA (default) RNAfold Evolution-coupling analysis method: GREMLIN (default) plmc mfDCA_apc header" is required -- Check the Job Queue Status