<?xml version="1.0" encoding="utf-8" standalone="yes" ?>
<rss version="2.0" xmlns:atom="http://www.w3.org/2005/Atom">
  <channel>
    <title>Evolution-coupling on Sparks Lab</title>
    <link>/tags/evolution-coupling/</link>
    <description>Recent content in Evolution-coupling on Sparks Lab</description>
    <generator>Hugo -- gohugo.io</generator>
    <lastBuildDate>Tue, 15 Sep 2020 00:00:00 +0000</lastBuildDate>
    
	<atom:link href="/tags/evolution-coupling/index.xml" rel="self" type="application/rss+xml" />
    
    
    <item>
      <title>SPOT-RNA2: Improved RNA Secondary Structure and Tertiary Base-pairing Prediction using Evolutionary Profile, Mutational Coupling and Two-dimensional Transfer Learning.</title>
      <link>/server/spot-rna2/</link>
      <pubDate>Tue, 15 Sep 2020 00:00:00 +0000</pubDate>
      
      <guid>/server/spot-rna2/</guid>
      <description>Our resources are limited and this webserver is sharing by 10-12 other predictors. Therefore, SPOT-RNA2 prediction can take few days. Please don&amp;rsquo;t submit the same sequence again. If need urgent prediction, please contact jaswinder.singh3@griffithuni.edu.au
Submit   E-mail address (required):    Target (optional):    Input your RNA Sequences:  Maximum: 500 nts, Only one RNA sequence at a time   &amp;gt;6cae-1-1y GGGUGAUUAGCUCAGGGGAGAGCACCUCCCUACAAGGAGGGGGUCGGCGGUUCGAUCCCG UCAUCACCCACCA</description>
    </item>
    
    <item>
      <title>RNAcmap: A Fully Automatic Server for RNA Contact Map Prediction by Evolutionary Coupling</title>
      <link>/server/rnacmap/</link>
      <pubDate>Mon, 13 Jan 2020 00:00:00 +0000</pubDate>
      
      <guid>/server/rnacmap/</guid>
      <description>Submit  E-mail address (optional):    Target (optional):    Input your RNA Sequences:  Maximum: 500 nts, Only one RNA sequence at a time   &amp;gt;Example sequence 3Q3Z_A GCGCGGAAACAAUGAUGAAUGGGUUUAAAUUGGGCACUUGACUCAUUUUGAGUUAGUAGU GCAACCGACCGUGCU     Secondary structure prediction method:  SPOTRNA (default) RNAfold     Evolution-coupling analysis method:  GREMLIN (default) plmc mfDCA_apc     header&#34; is required -- 
Check the Job Queue Status</description>
    </item>
    
  </channel>
</rss>