/tags/canonical-bps/ Recent content in Canonical bps on Sparks Lab Hugo -- gohugo.io Tue, 15 Sep 2020 00:00:00 +0000 /server/spot-rna2/ Tue, 15 Sep 2020 00:00:00 +0000 /server/spot-rna2/ Our resources are limited and this webserver is sharing by 10-12 other predictors. Therefore, SPOT-RNA2 prediction can take few days. Please don’t submit the same sequence again. If need urgent prediction, please contact jaswinder.singh3@griffithuni.edu.au Submit E-mail address (required): Target (optional): Input your RNA Sequences: Maximum: 500 nts, Only one RNA sequence at a time >6cae-1-1y GGGUGAUUAGCUCAGGGGAGAGCACCUCCCUACAAGGAGGGGGUCGGCGGUUCGAUCCCG UCAUCACCCACCA